Skip to main content

Table 1 Characteristics of 18 microsatellite loci used in this study

From: Establishment of a microsatellite set for noninvasive paternity testing in free-ranging Macaca mulatta tcheliensis in Mount Taihangshan area, Jiyuan, China

Locus Primer sequence DNA source Species Topic References
D12S372 TGGACCACAGGGTATCATCT Blood and tissue Rhesus macaques Loci screened Rogers et al. 2005
D9S934 TTTCCTAGTAGCTCAAGTAAAGAG Blood and tissue Rhesus macaques Loci screened Rogers et al. 2005
D16S403 GTTTTCTCCCTGGGACATTT Blood and tissue Rhesus macaques Loci screened Rogers et al. 2005
D1S548 GAACTCATTGGCAAAAGGAA Blood Pig-tailed macaques Paternity testing Perwitasari-Farajallah 2007
D3S1768 GGTTGCTGCCAAAGATTAGA Blood Rhesus macaques Paternity testing Kanthaswamy and Smith 1998
D5S820 ATTGCATGGCAACTCTTCTC Blood Rhesus macaques Loci screened Kayser et al. 1996
D6S311 ATGTCCTCATTGGTGTTGTG Blood Rhesus macaques Paternity testing Xu et al. 2013
D5S1457 TAGGTTCTGGGCATGTCTGT Blood Rhesus macaques Paternity testing Kanthaswamy and Smith 1998
D6S2741 CTGCACTTGGCTATCTCAAC Blood Rhesus macaques Genotyping Penedo et al. 2005
D14S306 AAAGCTACATCCAAATTAGGTAGG Blood Rhesus macaques Paternity testing Xu et al. 2013
D3S3045 ACCAAATGAGACAGTGGCAT Blood and tissue Rhesus macaques Loci screened Rogers et al. 2005
D21S1246 GATAAAGTAGACAGGTAAACA Blood and tissue Rhesus macaques Loci screened Rogers et al. 2005
D6S2419 CTAATTTGTAGATTTAAGCCTTTGC Blood and tissue Rhesus macaques Loci screened Rogers et al. 2005
D7S513 AGTGTTTTGAAGGTTGTAGGTTAAT Blood Rhesus macaques Polymorphism analyzing Li et al. 2009
D4S1645 CAACTTTCTTCAATAAATTTGGC Blood and tissue Rhesus macaques Loci screened Rogers et al. 2005
D15S644 CCTTCATTGGCAGACTCACT Blood Rhesus macaques Kinship estimating Smith et al. 2000
D12S67 GCAACAGTTTATGCTAAAGC Blood Rhesus macaques Genotyping Kayser et al. 1995
D18S536 ATTATCACTGGTGTTAGTCCTCTG Blood Rhesus macaques Kinship estimating Smith et al. 2000