Skip to main content

Advertisement

Table 1 PCR primers for amplification of the complete mitogenome of three rhombosoleid species

From: Complete mitochondrial genome sequences of three rhombosoleid fishes and comparative analyses with other flatfishes (Pleuronectiformes)

Forward Sequence (5′-3′ ) Reverse Sequence (5′-3′ )
Pleur-Z15 ATTAAAGCATAACHCTGAAGATGTTAAGAT Pleur-F6746 GCGGTGGATTGTAGACCCATARACAGAGGT
Pleur-Z2625 GTTTACGACCTCGATGTTGGATCAGGACAT Pleur-F13413 TAGCTGCTACTCGGATTTGCACCAAGAGT
Pleur-Z10818 TTYGAAGCAGCCGCMTGATACTGACAYTT H15149 AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA
L14734 CGAAGCTTGATATGAAAAACCATCGTTG Pleur-F17147 TAGTTTARTGCGAGAATCCTAGCTTTGGG
Pleur-Z17054 GYCGGTGGTTARAATCCTCCCTACTGCT Pleur-F11089 TTTAACCAAGACCRGGTGATTGGAAGTC
Pleur-Z13347 AAGGATAACAGCTCATCCGTTGGTCTTAGG Pleur-F2753 TAGATAGAAACTGACCTGGATTACTCCGGT
Z-Ser CTCGCAGCAATGAACACT 16SBR CCGGTCTGAACTCAGATCACGT
Z-6188 GGTGAAAATCCCTTAGTCCC F12-F-ATP6 ATGTAAAGGCAGCGGTAG
R-COI-8010 CCMCGACGCTACTCTGACTA F12-F-12S TGTCTATCACTGCTGGGTT
F18-Z-Ile CTTGCCCTGGTTGTATGA F-49 GGCCCATCTTAACATCTTC
F18-Z-Arg CCCCAAATAAACCCTGAC F18-F-COII CTATCCGAGCCTGAACAA
F18-Z-ND4 GCTTTGCCTACTGGTCAT F18-F-ND4 TCCCACATCCGTCGTCAT
F20-Z-49 CAGCCCTCACAAGACACT F-14170 ATTCCTCCTCTTTGTGGG
Z-6487 AGCAGACACTCTAATTAAGC F18-F-Cytb CGTCCCTCCAGTTGCTCT
F12-Z-Gln GAGATCAAAACTCTTAGTGC F-5196 CTAAATGGTTGGGGTATGG
F20-Z6883 TCGGCTCACTTATTTCCC F20-F7749 ACGAGTGGAGGACATCTT
F20-Z-13347-2 GCCCTCCTCGTAACTTGA F20-F-17054-2 CCCTCACCCTCAATAAGA