Skip to main content

Advertisement

Table 1 Marker list with location, primer name, primer sequence, PCR annealing temperature, and restriction enzyme

From: Genetic analysis of parthenogenetic capability and fecundity in Drosophila albomicans

Location Primer name Primer sequence Annealing temperature (°C) Restriction enzyme Reference
Second chromosome a28 F: GGGGCACACTGATTTATTAAACAA 57 Alu I Chang et al. ([2008])
R: TATTTTACGCCACAACTTGCAGCAC
a708 F: GAAAAGGGCGAACAGATAGA 55 Xmn I Chang ([2011])
R: AACAGGAACATAGAAATCAC
A185D F: CAAACGCTCTGGAATAATGG 55 Rsa I Chang ([2011])
R: CTCGGGAGTGTGGGGC
c4081 F: GCCCTGGAACAAAGTGAAAA 52 Hae III This study
R: AGTCTGCTGCGTATGGTCAA
c5237 F: TATATGTTCCTCCTGATTGG 55 Pst I Chang ([2011])
R: AAGTTTAAACGCGAACTTTT
c5665 F: TGAAACATTATTACCGCCTG 60 Hae III This study
R: GATGACGACGACGATTCC
c7198 F: GTGGGAAGCACGTTACAT 57 Mse I Chang ([2011])
R: CCATGAACAGTCTGAAGTTT
neo-X chromosome arm a52 F: TATTCATCGCATTCCACAT 53 Hae III Chang et al. ([2008])
R: GGCTTCCTCAATCAACTG
a386 F: GTTACGATTACGAAGAGTGC 51 Xmn I Chang et al. ([2008])
R: CTGCCGTGCTTATGTGAT
a1185 F: ATTCTGTCGTTCGTTTTGA 49 Sty I Chang et al. ([2008])
R: GATTTCGGCTTACATTATTG
a1350 F: TACGACCCCGTCAAAGGCTGTG 52 Hpa II Chang ([2011])
R: GGCTTGTATGCGATTCTGC
a1953 F: GCCAACAGCGAGCCTTCT 56 Dde I Chang et al. ([2008])
R: GCGACCCAAGCACGAATC
c29 F: CTGGGCAAAGAGTGTAGG 57 Rsa I Chang et al. ([2008])
R: CAGAAGGAGGGCGAAAA
c3242 F: TTGAAGCGCAGTTTATGCAC 62 Ssp I Chang ([2011])
R: TACAACCACGACCTGGACAA