Skip to main content

Table 2 Primers used to amplify the mitochondrial conserved region, Cyt b , mitochondrial D-loop, and RAPD analysis

From: DNA variations of the green toad Pseudepidalea viridis (syn. Bufo viridis) from various habitats

Analysis Primer Sequence 5′-3′ Reference
Cyt b CB2Xen-H CCCTCAAAAAGATATTTGTCCTCA Palumbi et al. (2002)
D-loop ContBH GTCCATTGGAGGTTAAGATCTACCA Goebel et al. (1999)
RAPD OPA2 TGCCGAGCTG Mikulicek and Pialek (2003)