Skip to main content
Zoological Studies
Download PDF

Complete mitochondrial genome sequences of three rhombosoleid fishes and comparative analyses with other flatfishes (Pleuronectiformes)

Zoological Studies volume 53, Article number: 80 (2014) Cite this article

Abstract

Background

Peltorhamphus novaezeelandiae, Colistium nudipinnis, and Pelotretis flavilatus belong to the family Rhombosoleidae of Pleuronectiformes. Their high phenotypic similarity has provoked great differences in the number and nomenclature of the taxa that depend primarily on morphological features. These facts have made it necessary to develop molecular markers for taxonomy and phylogenetic studies. In this study, the complete mitogenomes (mtDNA) of the three rhombosoleid fishes were determined for the comparative studies and potential development of molecular markers in the future.

Results

The lengths of the complete mitogenome of the three flatfishes are 16,889, 16,588, and 16,937 bp in the order mentioned above. The difference of lengths mainly results from the presence of tandem repeats at the 3′-end with variations of motif length and copy number in the control regions (CR). The gene content and arrangement is identical to that of the typical teleostean mtDNA. Two large intergenic spacers of 28 and 18 bp were found in P. flavilatus mtDNA. The genes are highly conserved except for the sizes of ND1 (which is 28 bp shorter than the two others), ND5 (13 bp longer), and tRNA Glu (5 bp longer) in P. flavilatus mtDNA. The symbolic structures of the CRs are observed as in other fishes, including ETAS, CSB-F, E, D, C, B, A, G-BOX, pyrimidine tract, and CSB2, 3.

Conclusions

Comparative genomic analysis within rhombosoleids revealed that the mitogenomic feature of P. flavilatus was significantly different from that of the two others. Base composition, gene arrangement, and CR structure were carried on in the 17 mitogenomes. Apart from gene rearrangement in two tongue soles (Cynoglossus semilaevis and Cynoglossus abbreviatus), the gene order in 15 others is identical to that of the typical fish mitogenomes. Of the 16 studied mitogenomes, 15 species (except for Zebrias zebrinus) have tandem repeats at the 3′-, 5′-, or both 3′- and 5′-ends of the CRs. Moreover, the motif length and copy number intraspecies or interspecies are also variable. These phenomena fully indicate the diversity of repeats in flatfish mtDNA and would provide useful data for studies on the structure of mitogenomes in fishes.

Background

Flatfishes share a common asymmetrical body and bottom-dwelling mode of life. Their high phenotypic similarity has provoked great confusion in the number and nomenclature of taxa depending on the relevance assigned to morphological features (Chapleau [1993]; Cooper and Chapleau [1998]; Hoshino [2001]). These facts have made it necessary to develop molecular markers to figure out controversial aspects of flatfish systematics.

Generally, mitochondrial DNA (mtDNA) in vertebrata consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, 1 origin of replication on the light strand (OL), and a single large control region (CR). Most genes are encoded by the heavy (H-) strand while only the ND6 gene and eight tRNA genes are encoded by the light (L-) strand (Boore [1999]). Due to its simple structure, the lack of recombination, multi-copy status in a cell, maternal inheritance, and high evolutionary rate, the mtDNA has been extensively used for population genetic study and phylogenetic analysis (Miya et al. [2003]; Inoue et al. [2010]; Shi et al. [2011]).

To date, several genes of mtDNA have been used as molecular markers in the establishment of phylogenetic relationships among flatfishes, such as rRNA genes (Azevedo et al. [2008]), the cytochrome b gene (Borsa and Quignard [2001]), the control region (Tinti et al. [1999]), and their combinations (Infante et al. [2004]). Nevertheless, it has been shown that the use of limited sequence data and markers with different evolving rates may cause errors in inferences of the evolutionary relationships among taxa. In this sense, complete mitochondrial genomes have demonstrated their ability in resolving persistent controversies over higher level relationships of teleost (Miya et al. [2003]; Kawahara et al. [2008]; Inoue et al. [2010]; Shi et al. [2011]). Currently, the complete mtDNA sequences of more than 1,000 fish species have been determined (as of 21 April 2013, http://www.ncbi.nlm.nih.gov/), including 14 species from 6 families in Pleuronectiformes.

Peltorhamphus novaezeelandiae (common sole), Colistium nudipinnis (turbot), and Pelotretis flavilatus (lemon sole) belong to the family Rhombosoleidae of Pleuronectiformes (Nelson [2006]). These fishes are primarily in a South Pacific group, occurring mostly around Australia and New Zealand. Up to now, there has been controversy over the taxonomic status of the rhombosoleids. Regan ([1910]) separated Pleuronectidae into three subfamilies: Pleuronectinae, Samarinae, and Rhombosoleinae, and Hubbs ([1945]) also admitted this opinion. Then, Chabanaud ([1946]) recommended a familial ranking for Rhombosoleinae based on their three ‘highly important’ morphological characteristics. However, this recommendation was not widely accepted. Only some researchers agreed with the classification (Chapleau and Keast [1988]; Cooper and Chapleau [1998]; Guibord [2003]; Nelson [2006]), while the others kept using a subfamilial ranking (Sakamoto [1984]; Li and Wang [1995]; Schwarzhans [1999]; Evseenko [2004]).

Previously, there were no reports on the complete mitogenome of rhombosoleid fishes, and only a few mitogenomic fragments are available. In the present study, the complete mitochondrial sequences of the three rhombosoleid fishes were determined for the first time. The genomic features of these mitogenomes were analyzed and compared with other flatfish mtDNAs. The results of this study could provide useful data for the studies of mitogenome structures in fishes and the development of molecular markers to explore the classification issues within Rhombosoleidae and Pleuronectiformes in the future.

Methods

Sampling, DNA extraction, PCR, and sequencing

Fish samples were obtained from the Sydney fish market, Australia, and preserved in 75% ethanol. The ethical approval is not required because the specimen used in the present study was common marine captured economic fishes, and all fish specimens had died when we obtained them and they were sourced from commercial fisheries. Those species were not involved in the endangered list of IUCN. Total genomic DNAs were extracted from muscular tissues with DNA extraction kit (TIANGEN Biotech, Beijing, China) by following the manufacturer’s protocol.

The primers used to amplify the contiguous (Table 1), overlapping segments of complete mitochondrial genomes of the three rhombosoleid fishes were designed by aligning and comparing with previously reported mitogenomic sequences of flatfishes or other references (Palumbi et al. [1991]; Kong et al. [2009]; Shi et al. [2011]). The PCR was performed in a 25-μl reaction volume containing 0.2 mM dNTP, 0.5 μM of each primer, 1.0 U Taq polymerase (Takara, Dalian, China), 2.5 μl of 10× LA PCR Buffer II (Mg2+ Plus), and approximately 50 ng DNA template. The PCR cycling included an initial denaturation at 95°C for 3 min, 35 cycles of a denaturation at 95°C for 30 s, an annealing step at 48°C for 40 s, elongation at 68°C to 72°C for 1 to 4 min, and a final extension at 72°C for 10 min. The PCR products were detected in 1.0% agarose gels, purified with the Takara Agarose Gel DNA Purification Kit (Takara Bio Inc., Beijing, China) and used directly as templates for the cycle sequencing reactions in both directions (with ABI 3730 DNA sequencer, Life Technologies Biotechnology Corporation, Shanghai, China). Fragments that could not be directly sequenced were inserted into the pMD20-T vector (Takara), transformed into E. coli DH5α for cloning and then sequenced. The new primers were designed for walking sequencing. An overlap of more than 30 bp between the two adjacent sequences was used to ensure the correct assembly and integrity of the complete sequences.

Table 1 PCR primers for amplification of the complete mitogenome of three rhombosoleid species
Full size table

The sequenced fragments were assembled into complete mitochondrial genomes using CodonCode Aligner (vers. 3, CodonCode Corporation, Dedham, MA, USA) and BioEdit (Hall [1999]). Annotation and boundary determination of protein-coding genes and rRNA genes were performed using NCBI-BLAST (http://blast.ncbi.nlm.nih.gov). Alignments with previously published mitogenomic sequences of flatfishes and other closely related bony fishes were carried out to ensure accuracy (Table 2). The transfer RNA genes and their secondary cloverleaf structures were identified using tRNAscan-SE 1.21 (Lowe and Eddy [1997]), with cutoff values set to 1 when necessary. The secondary structures of tRNA Ser(AGC) and tRNA Cys were further constructed by RNA structure (Reuter and Mathews [2010]) and confirmed by examination of their anticodons.

Table 2 Information of the mitogenomes sequences of 17 flatfishes used in present study
Full size table

To compare the mitogenome characteristics among Pleuronectiformes, the complete mitogenome sequences of 14 other flatfishes from 6 families were retrieved from GenBank (Table 2).

Results and discussion

Genome organization

The lengths of the P. novaezeelandiae, C. nudipinnis, and P. flavilatus mitogenomes are 16,889, 16,588, and 16,937 bp, respectively (GenBank accession no. JQ639065, JQ639063, KC554065; note, the order of the following data is the same as these). Their gene arrangements are identical to those of typical teleost species (Saitoh et al. [2000]; Yue et al. [2006]). All the three mitogenomes contain 13 protein-coding genes, two rRNA genes, 22 tRNA genes, one OL, and one CR. All genes are encoded by the H-strand except for the ND6 and eight tRNA genes, which were encoded on the L strand (Table 3). Base compositions of the three mitogenomes are 26.6% to 28.2%, 27.1% to 28.1%, 16.7% to 17.6%, and 27.7% to 28.1% for A, C, G, and T, respectively, with a bias on AT content (54.3% to 56.1%). A total of 34-, 28-, and 66-bp intergenic spacers are found in the three genomes. The majority of spacer lengths range from 1 to 7 bp except for the two larger spacers in P. flavilatus. One is 28 bp between tRNA Leu(UUA) and ND1, and the other is 18 bp between tRNA Asp and COII, which is a polymeric C fragment. A total of 37-bp, 37-bp, and 39-bp overlaps, respectively, were observed. The four notable over-lapping positions (ATP8 and ATP6, ATP6 and COIII, ND4L and ND4, ND5 and ND6) were also observed as reported in other vertebrate species (Kong et al. [2009]) (Table 3).

Table 3 Features of the mitogenomes of three rhombosoleid fishes
Full size table

Protein-coding genes

The sizes of the 13 protein-coding genes are 11,441 bp in P. novaezeelandiae and C. nudipinnis but are 11,424 bp in P. flavilatus. Comparison of the length of each gene reveals that the genes are highly conserved in size except for the ND1 gene (28 bp shorter) and the ND5 gene (13 bp longer) in P. flavilatus mtDNA. The start codons are identical in the three species. Eleven genes use the ATG, whereas COI starts with GTG, and ND3 with ATA, which has rarely been found in fish mitogenomes to date (other examples include Albula glossodonta, Monopterus albus, Petroscirtes breviceps, Solea senegalensis, and Cynoglossus semilaevis) (Miya et al. [2003]; Miya et al. [2001]; Inoue et al. [2004]; Kong et al. [2009]). Ten of the 13 genes use the same stop codons. The ND5 gene ends with TAA in P. novaezeelandiae and P. flavilatus and TAG in C. nudipinnis; the COII and cytb end with TAA in P. novaezeelandiae, but with T in C. nudipinnis and P. flavilatus (Table 3).

The base compositions of the 13 protein-coding genes are T > C > A > G. The proportions of the four bases have no apparent bias at the first codon position but have significant difference at the second and third positions. The percentage of T at the second position is up to 40.9% to 41.1%, but that of G is only 13.6% to 13.8%. In particular, G at the third position is only 9.6% to 12.5%, which is in agreement with previous reports (Saitoh et al. [2000]; Miya et al. [2003]; Oh et al. [2007]). There is a slight difference in codon usage among three rhombosoleids. The most frequently used amino acid is leucine (16.5% to 17.2%), while cysteine (0.7% to 0.8%) is the least frequently used. The level of homology of genes between the three rhombosoleid species ranges from 63% (ND2 gene) to 85% (COII gene). The similarity between C. nudipinnis and P. flavilatus is generally higher than that between P. novaezeelandiae and each of these two fishes (Figure 1).

Figure 1
figure 1

Sequence identities of 13 protein genes and two rRNA genes among the three rhombosoleids.

Full size image

Ribosomal and transfer RNA genes

Two rRNA genes are typically located between tRNA Phe and tRNA Leu (UUA) and separated by tRNA Val (Table 3). The lengths of 12S rRNA genes are similar and those of 16S rRNA have approximately 15 bp differences among three species (Table 3). The level of homology of rRNA genes is very similar in 12S rRNA but slightly different in 16S rRNA among the three rhombosoleids (Figure 1).

The 22 tRNA genes are interspersed between rRNA and protein-coding genes. Most of these tRNAs are of similar length as those in other fishes, except for tRNA Glu, which is 5 bp longer in P. flavilatus than those in the other fishes. The majority of tRNA genes could be recognized and folded into secondary structures by tRNAscan-SE, except for two genes that were identified by comparing with other flatfishes. One is the tRNA Ser(AGC) gene in C. nudipinnis and P. flavilatus, which is the common case in fishes, and another is the tRNA Cys gene, in which the dihydrouracil loop cannot be formed in any of the three fishes’ mtDNA. The lengths are7, 5, 4, and 5 bp for that of the amino acid arm, anticodon arm, and DHU and TΨC arm, respectively. Both the anticodon and TΨC loop are 7 nucleotides long, whereas DHU loop size varies from 5 to 11 nucleotides.

Non-coding sequences

The OL is normally located between tRNA Asn and tRNA Cys in the WANCY region and is from 38 to 44 bp in size. These regions have the potential to fold into a stem-loop structure with 13 or 14 bp in the arms and 10 or 14 nucleotides in the loops. The highly conserved sequence motif 5′-GCCAG-3′ is substituted by 5′-GCCGG-3′ (Figure 2).

Figure 2
figure 2

The stem-loop structures of O L in the mitogenomes of three rhombosoleids. The underlined sequences indicate the conserved sequence motif. (a) P. novaezeelandiae, (b) C. nudipinnis, and (c) P. flavilatus.

Full size image

The control regions are commonly situated in the location between tRNA Pro and tRNA Phe. Their lengths are quite different and are 919, 1,212, and 1,218 bp in C. nudipinnis, P. novaezeelandiae, and P. flavilatus, respectively (Table 3). These differences mainly result from the presence of tandem repeats at the 3′-end, in which the motif length and copy number of tandem repeat are variable. There are two 7-bp motifs with 6 or 39 copies in P. novaezeelandiae, a 17-bp motif with seven copies in C. nudipinnis, and a 145-bp motif with three copies in P. flavilatus (Figure 3).

Figure 3
figure 3

Alignment of the control regions of P. novaezeelandiae ( P.nov ), C. nudipinnis ( C.nud ), and P. flavilatus ( P.fla ) mtDNA. The blocks CSB-A, B, C, D, E, F, poly-T, and CSB-2 and CSB-3 are shaded. CSB, conserved sequence block. The sequence in parentheses indicates the motif of the tandem repeat, and the arabic number indicates the copy number.

Full size image

The AT contents of the CRs reach up to 64.4% to 66.7%, which are higher than those of the whole mtDNA sequences. The symbolic structures of the CRs are observed as in other fishes (Figure 3), including the extended termination associated sequence (ETAS, containing TAS-cTAS: TACAT-ATGTA), central conserved sequence blocks (CSB-F,E,D), G-BOX (GTGGGGG), pyrimidine tract (poly-T), and conserved sequence blocks (CSB 2-3) (Nesbo et al. [1998]; Manchado et al. [2007]; Wang et al. [2013]).

Comparative analyses with other flatfishes

Up to now, 14 mitogenome sequences from other flatfishes had been determined (Table 2). To better understand their features of mtDNAs, a comparative analysis was carried out in several aspects.

First of all, the content of the 17 mitogenome sequences (including three from the present study) are the same, which consists of 37 genes, 1 OL, and 1 CR. However, the gene arrangements differ among them. Apart from the two tongue soles (C. semilaevis and C. abbreviatus), the orders of the 15 others are identical to that of the typical fish mitogenomes. The organization of the tongue sole mitogenomes differed, in which the tRNA Glngene is inverted from the light strand to the heavy strand (inversion), accompanied by shuffling of the tRNA Ile gene and long-range translocation of the control region downstream to a site between the ND1 and the tRNA Gln genes.

The lengths of the 17 mitogenome sequences show apparent differences (from 15,973 bp of Kareius bicoloratus to 18,017 bp of Reinhardtius hippoglossoides). The reason for the short CR in K. bicoloratus mtDNA is due to the unfinished sequencing of CR and that for two other tongue soles (16,417 bp or 16,731 bp) is due to the rearrangement of the CR. The variations for the other fishes are primarily caused by the presence of the repeated arrays in control regions.

The proportions of three bases (A\T\C) have no obvious difference, ranging from 20% to 30%; however, that of G is remarkably lower, from 14.5% (C. semilaevis) to 17.7% (Platichthys stellatus). The AT compositions in the 15 species mitogenomes are generally approximately 50% (from 53.21% to 56.08%), but those of the two tongue soles reach up to 60.35% and 60.59% (Table 2).

Gene region

The lengths of the gene sequences are relatively conservative, except for the ND2 gene (1,110 bp) of Scophthalmus maximus (approximately 50 bp longer) and the ND1 gene (948 bp) of P. flavilatus (approximately 25 bp shorter). For the other genes, no significant difference was observed.

In this study, the AT and GC skews of 13 proteins in the 17 flatfish mitogenomes were analyzed. Compositional skew was estimated using the following formulas: GC skew = (G − C)/(G + C) and AT skew = (A − T)/(A + T), where C, G, A, and T are the frequencies of the four bases at the third codon position of the eight fourfold degenerate codon families (Perna and Kocher [1995]). With the exception of AT skew in C. nudipinnis, 16 of 17 mtDNAs show a typical negative GC skew and positive AT skew. The absolute values of the GC skews are always higher than those of the AT skews, with the former ranging from 0.45 to 0.71 and the latter from 0.02 to 0.39 (Table 2). These results indicate that the usage of the G/C was more unbalanced than the A/T in the studied flatfishes.

Non-coding sequences

All the OL of the 17 flatfishes mitogenomes are situated at the typical site of bony fishes. The lengths range from 41 bp (C. abbreviatus) to 50 bp (Zebrias zebrinus) (Table 2). All these regions have the potential ability to fold into a stem-loop structure with 11 to 15 bp in the arms and 10 to 15 bp nucleotides in the loops. The highly conserved sequence motif of 5′-GCCGG-3′ is substituted in some species, such as by 5′-CCCGG-3′ in Z. zebrinus, 5′-GCCAG-3′ in rhombosoleids, and 5′-ACCGG-3′ in Paralichthys olivaceus and S. maximus (Table 2).

The control region of the 14 mitogenomes (excluding the unfinished one K. bicoloratus) is typically situated in the place between tRNA Pro and tRNA Pheexcept for the two tongue soles (which is between ND1 and tRNA Gln). The lengths are quite different, from 661 bp (C. abbreviatus) to 2,312 bp (R. hippoglossoides). The differences of length primarily result from the presence of tandem repeats within the CR. The repeat regions in Psettodes erumei exist at both 5′- and 3′- ends of the CR, while that in the others are located at either the 5′-end in the tongue soles or the 3′-end in the rest fishes. The motif lengths and copy numbers of tandem repeat are variable within species or interspecies (Table 2). The specific case is the absence of a repeat region in Z. zebrinus.

Based on the alignment of CR sequences of 14 flatfishes, the typical tripartite structure was found as those in P. novaezeelandiae, C. nudipinnis, and P. flavilatus mtDNA. The six blocks of CSB-F, E, D, C, B, and A were identified in the central conserved blocks domain, and the key sequences of each block are as follows: CSB-F: GTAAGAGCCTACCAACCGG, CSB-E: GGGTGAGGGACAAAAATT -GTGGGGG, CSB-D: TATTCCTGGCATTTGGTTCC-TACTTCAGGGCCAT, CSB-C: CTTACATAAGTTAATG, CSB-B: CATACGACTCGTTACCCAGCAAGCCGGGCGTTC; CSB-A: CTCCAGCGGGTAAGGGG. The G-box (GTGGGGG) is the most conservative in CSB-E. Simultaneously, a pyrimidine tract following the CSB-A was also identified (TTCTC-TTTTTT TTTTTCCTTTC). Two conserved sequence blocks of CSB-2 and CSB-3 at the 3′-end of the CR were identifiable; their sequences are CSB-2: AAAACCCCCC-TACCCCCCTAAA and CSB-3: CCTGAAAACCCCCCGG, respectively (see Additional file 1).

Generally, the variation of the control region is relatively greater than that of the other sequences in the mitogenome. However, there have also been some conserved structures in the CR as they are supposed to contain the functional structures, such as the origins of the H-strand (OH), the heavy strand promoter (HSP), and light strand promoter (LSP) of transcription transcripts (Shadel and Clayton [1997]). So far, the sequences of some conserved blocks have not been defined. Generally, only the TAS, CSB-F, E, and D of the central conserved blocks are identified in most fishes, while the CSB-C, B, and A are greatly variable (Lee et al. [1995]; Guo et al. [2003]; Manchado et al. [2007]; Zhang et al. [2010]), and CSB-1,2,3 have been found only in some fishes (Lee et al. [2001]; Liu [2002]; Guo et al. [2003]).

Conclusions

We sequenced the complete mitogenomes of three rhombosoleid fishes in the Pleuronectiformes. Comparative genomic analysis within the rhombosoleids revealed that the genomic feature of P. flavilatus is apparently different from the other two.

The comparison of complete mitogenome sequences of 3 rhombosoleids with that of the other 14 flatfishes show some different features among them. Firstly, the genomic arrangement of the 15 mitogenomes is identical to that of a typical teleost, but the order of two tongue soles showed clear rearrangements. Secondly, the length heterogeneity is apparently large and up to 1,600 bp. The main reason for this case is due to the presence of repeat regions in the CRs. The 15 species have tandem repeats, which were distributed at all potential existing sites in the CR, including 3′-, 5′-, or both 3′- and 5′-ends of the CR. Moreover, the motif length and copy number in intraspecies or interspecies are also variable. Thirdly, six blocks of CSB-F, E, D, C, B, and A in the central conserved blocks domain and CSB-2 and CSB-3 in the conserved sequence blocks were identified. However, CSB-1 is not conserved in the flatfishes studied. These phenomena fully indicated the diversity of repeats in flatfishes and would provide useful data for further studies on the structure of mitogenomes in fishes.

Summarily, the complete mitogenomic sequences of rhombosoleids and rich molecular information were obtained in this study. It will contribute to figuring out the existing controversy, such as the taxonomic status and phylogenetic relations of rhombosoleids. Comparative genomics analysis within flatfishes conducted here may help better understand the evolution of mitogenomic structures and explore the phylogenetic relationships of the Pleuronectiforms.

Data accession

Sequences were deposited in the NCBI [no. JQ639065, JQ639063, KC554065].

Additional file

References

  1. Azevedo MFC, Oliveira C, Pardo BG, Martinez P, Foresti F: Phylogenetic analysis of the order Pleuronectiformes (Teleostei) based on sequences of 12S and 16S mitochondrial genes. Genet Mol Biol 2008,31(1):284–292. 10.1590/S1415-47572008000200023

    Article  CAS  Google Scholar 

  2. Boore J: Animal mitochondrial genomes. Nucleic Acids Res 1999, 27: 1767–1780. 10.1093/nar/27.8.1767

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  3. Borsa P, Quignard JP: Systematics of the Atlantic-Mediterranean soles Pegusa impar, P. lascaris, Solea aegyptiaca, S. senegalensis, and S. solea (Pleuronectiformes:Soleidae). Can J Zool 2001,79(12):2297–2302.

    Google Scholar 

  4. Chabanaud P: Sur le véritable caractère externe, par quoi les Soleiformes diffèrent des Pleuronectiformes. Bull Mus Natl Hist Nat 1946, 18: 158–160.

    Google Scholar 

  5. Chapleau F: Pleuronectiform relationships: a cladistic reassessment. Bull Mar Sci 1993,52(1):516–540.

    Google Scholar 

  6. Chapleau F, Keast A: A phylogenetic reassessment of the monophyletic status of the family Soleidae, with comments on the suborder Soleoidei (Pisces; Pleuronectiformes). Can J Zool 1988,66(12):2797–2810. 10.1139/z88-408

    Article  Google Scholar 

  7. Cooper JA, Chapleau F: Monophyly and intrarelationships of the family Pleuronectidae (Pleuronectiformes), with a revised classification. Fish Bull 1998,96(4):686–726.

    Google Scholar 

  8. Evseenko S: Family Pleuronectidae Cuvier 1816—righteye flounders. Calif Acad Sci Annotated Checklists Fishes 2004, 37: 1–37.

    Google Scholar 

  9. Guibord AC: Taxonomic revision of the Poecilopsettidae and phylogenetic analysis of the Rhombosoleidae and Pleuronectiformes (Acanthopterygii): Révision toxinomique des Poecilopsettidae et phylogénèse des Rhombosoleidae et des Pleuronectiformes (Acanthopterygii). Univ Ottawa, Ottawa; 2003.

    Google Scholar 

  10. Guo X, Liu S, Liu Y: Comparative analysis of the mitochondrial DNA control region in cyprinids with different ploidy level. Aquaculture 2003,224(1):25–38. 10.1016/S0044-8486(03)00168-6

    Article  CAS  Google Scholar 

  11. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999, 41: 95–98.

    CAS  Google Scholar 

  12. Hoshino K: Homologies of the caudal fin rays of Pleuronectiformes (Teleostei). Ichthyol Res 2001,48(3):231–246. 10.1007/s10228-001-8141-6

    Article  Google Scholar 

  13. Hubbs CL: Phylogenetic position of the Citharidae, a family of flatfishes. University of Michigan Press, Canton; 1945.

    Google Scholar 

  14. Infante C, Catanese G, Manchado M: Phylogenetic relationships among ten sole species (Soleidae, Pleuronectiformes) from the Gulf of Cadiz (Spain) based on mitochondrial DNA sequences. Mar Biotechnol 2004,6(6):612–624. 10.1007/s10126-004-3081-6

    Article  CAS  PubMed  Google Scholar 

  15. Inoue JG, Miya M, Tsukamoto K, Nishida M: Mitogenomic evidence for the monophyly of elopomorph fishes (Teleostei) and the evolutionary origin of the leptocephalus larva. Mol Phylogenet Evol 2004,32(1):274–286. 10.1016/j.ympev.2003.11.009

    Article  CAS  PubMed  Google Scholar 

  16. Inoue JG, Miya M, Miller MJ, Sado T, Hanel R, Hatooka K, Aoyama J, Minegishi Y, Nishida M, Tsukamoto K: Deep-ocean origin of the freshwater eels. Biol Lett 2010,6(3):363–366. 10.1098/rsbl.2009.0989

    Article  PubMed Central  PubMed  Google Scholar 

  17. Kawahara R, Miya M, Mabuchi K, Lavoue S, Inoue JG, Satoh TP, Kawaguchi A, Nishida M: Interrelationships of the 11 gasterosteiform families (sticklebacks, pipefishes, and their relatives): a new perspective based on whole mitogenome sequences from 75 higher teleosts. Mol Phylogenet Evol 2008,46(1):224–236. 10.1016/j.ympev.2007.07.009

    Article  CAS  PubMed  Google Scholar 

  18. Kong X, Dong X, Zhang Y, Shi W, Wang Z, Yu Z: A novel rearrangement in the mitochondrial genome of tongue sole, Cynoglossus semilaevis: control region translocation and a tRNA gene inversion. Genome 2009,52(12):975–984. 10.1139/G09-069

    Article  CAS  PubMed  Google Scholar 

  19. Lee WJ, Conroy J, Howell WH, Kocher TD: Structure and evolution of teleost mitochondrial control regions. J Mol Evol 1995,41(1):54–66. 10.1007/BF00174041

    Article  CAS  PubMed  Google Scholar 

  20. Lee J-S, Miya M, Lee Y-S, Kim CG, Park E-H, Aoki Y, Nishida M: The complete DNA sequence of the mitochondrial genome of the self-fertilizing fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and the first description of duplication of a control region in fish. Gene 2001,280(1):1–7. 10.1016/S0378-1119(01)00765-X

    Article  CAS  PubMed  Google Scholar 

  21. Li SZ, Wang HM: Fauna Sinica (Osteichthyes): Pleuronectiformes. Science Press, Beijing; 1995.

    Google Scholar 

  22. Liu H: Structure and evolution of fish mitochondrial control region, bitterlings as example. Prog Nat Sci 2002, 12: 266–270.

    Google Scholar 

  23. Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 1997,25(5):955–964. 10.1093/nar/25.5.0955

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  24. Manchado M, Catanese G, Ponce M, Funes V, Infante C: The complete mitochondrial genome of the Senegal sole, Solea senegalensis Kaup. Comparative analysis of tandem repeats in the control region among soles. Mitochondrial DNA 2007,18(3):169–175.

    CAS  Google Scholar 

  25. Miya M, Kawaguchi A, Nishida M: Mitogenomic exploration of higher teleostean phylogenies: a case study for moderate-scale evolutionary genomics with 38 newly determined complete mitochondrial DNA sequences. Mol Biol Evol 2001,18(11):1993–2009. 10.1093/oxfordjournals.molbev.a003741

    Article  CAS  PubMed  Google Scholar 

  26. Miya M, Takeshima H, Endo H, Ishiguro NB, Inoue JG, Mukai T, Satoh TP, Yamaguchi M, Kawaguchi A, Mabuchi K, Shirai SM, Nishida M: Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Mol Phylogenet Evol 2003,26(1):121–138. 10.1016/S1055-7903(02)00332-9

    Article  CAS  PubMed  Google Scholar 

  27. Nelson JS: Fishes of the World(Fourth Edition). John Wiley, Inc, New York; 2006.

    Google Scholar 

  28. Nesbo CL, Arab MO, Jakobsen KS: Heteroplasmy, length and sequence variation in the mtDNA control regions of three percid fish species ( Perca fluviatilis , Acerina cernua , Stizostedion lucioperca ). Genetics 1998,148(4):1907–1919.

    PubMed Central  CAS  PubMed  Google Scholar 

  29. Oh DJ, Kim JY, Lee JA, Yoon WJ, Park SY, Jung YH: Complete mitochondrial genome of the rock bream Oplegnathus fasciatus (Perciformes, Oplegnathidae) with phylogenetic considerations. Gene 2007,392(1–2):174–180. 10.1016/j.gene.2006.12.007

    Article  CAS  PubMed  Google Scholar 

  30. Palumbi S, Martin A, Romano S, McMillan W, Stice L, Grabowski G (1991) The Simple Fool’s Guide to PCR, Version 2.0, privately published document compiled by S. Palumbi. Dept. Zool Univ Hawaii Honolulu HI 96:822

    Google Scholar 

  31. Perna NT, Kocher TD: Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J Mol Evol 1995,41(3):353–358. 10.1007/BF01215182

    Article  CAS  PubMed  Google Scholar 

  32. Regan CT: The origin and evolution of the teleostean fishes of the order Heterosomata. Ann Mag Nat Hist 1910, 6: 484–496. 10.1080/00222931008692879

    Article  Google Scholar 

  33. Reuter JS, Mathews DH: RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 2010, 11: 129. 10.1186/1471-2105-11-129

    Article  PubMed Central  PubMed  Google Scholar 

  34. Saitoh K, Hayashizaki K, Yokoyama Y, Asahida T, Toyohara H, Yamashita Y: Complete nucleotide sequence of Japanese flounder ( Paralichthys olivaceus ) mitochondrial genome: structural properties and cue for resolving teleostean relationships. J Hered 2000,91(4):271–278. 10.1093/jhered/91.4.271

    Article  CAS  PubMed  Google Scholar 

  35. Sakamoto K: Interrelationships of the family Pleuronectidae (Pisces: Pleuronectiformers). Mem Fac Fish Hokkaido Univ 1984, 31: 95–215.

    Google Scholar 

  36. Schwarzhans W: A comparative morphological treatise of recent and fossil otoliths of the order Pleuronectiformes. F. Pfeil, Verlag; 1999.

    Google Scholar 

  37. Shadel GS, Clayton DA: Mitochondrial DNA maintenance in vertebrates. Annu Rev Biochem 1997,66(1):409–435. 10.1146/annurev.biochem.66.1.409

    Article  CAS  PubMed  Google Scholar 

  38. Shi W, Kong XY, Wang ZM, Jiang JX: Utility of tRNA genes from the complete mitochondrial genome of Psetta maxima for implying a possible sister-group relationship to the Pleuronectiformes. Zool Stud 2011,50(5):665–681.

    CAS  Google Scholar 

  39. Tinti F, Colombari A, Vallisneri M, Piccinetti C, Stagni A: Comparative analysis of a mitochondrial DNA control region amplified from three Adriatic flatfish species and molecular phylogenesis of Pleuronectiformes. Mar Biotechnol 1999, 1: 20–24. 10.1007/PL00011747

    Article  CAS  PubMed  Google Scholar 

  40. Wang Z-M, Shi W, Jiang J-X, Wang S-Y, Miao X-G, Huang L-M, Kong X-Y: The complete mitochondrial genome of a striped sole Zebrias zebrinus (Pleuronectiformes: Soleidae). Mitochondrial DNA 2013,24(6):633–635. 10.3109/19401736.2013.772160

    Article  CAS  PubMed  Google Scholar 

  41. Yue G, Liew W, Orban L: The complete mitochondrial genome of a basal teleost, the Asian arowana ( Sclerophages formosus , Osteoglossidae). BMC Genomics 2006, 7: 242. 10.1186/1471-2164-7-242

    Article  PubMed Central  PubMed  Google Scholar 

  42. Zhang Y, Kong X, Wang Z: Characterization of mitochondrial control region sequence of Psettodes erumei and phylogenetic analysis of Pleuronectiformes. J Trop Oceanograph 2010,29(6):71–78.

    Google Scholar 

Download references

Acknowledgements

We are very grateful to Mr. Bernard Yau for his help in collecting the rhombosoleids samples from Australia. This study is supported by the National Natural Science Foundation of China (30870283 and 31471979).

Author information

Authors and Affiliations

  1. Key Laboratory of Tropical Marine Bio-resources and Ecology, Marine Biodiversity Collection of South China Sea, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou, 510301, China

    Shu-Ying Wang, Wei Shi, Xian-Guang Miao & Xiao-Yu Kong

Authors
  1. Shu-Ying Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Wei Shi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Xian-Guang Miao
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Xiao-Yu Kong
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Xiao-Yu Kong.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

SYW collected datasets, carried out experiments, and drafted the manuscript. WS and XGM carried out partial experiments. XYK directed the whole research work and revised the manuscript. All authors read and approved the final manuscript.

Electronic supplementary material

Authors’ original submitted files for images

Rights and permissions

Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wang, SY., Shi, W., Miao, XG. et al. Complete mitochondrial genome sequences of three rhombosoleid fishes and comparative analyses with other flatfishes (Pleuronectiformes). Zool. Stud. 53, 80 (2014). https://doi.org/10.1186/s40555-014-0080-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40555-014-0080-9

Keywords