Open Access

Complete mitochondrial genome sequences of three rhombosoleid fishes and comparative analyses with other flatfishes (Pleuronectiformes)

Zoological Studies201453:80

DOI: 10.1186/s40555-014-0080-9

Received: 22 July 2013

Accepted: 21 November 2014

Published: 17 December 2014

Abstract

Background

Peltorhamphus novaezeelandiae, Colistium nudipinnis, and Pelotretis flavilatus belong to the family Rhombosoleidae of Pleuronectiformes. Their high phenotypic similarity has provoked great differences in the number and nomenclature of the taxa that depend primarily on morphological features. These facts have made it necessary to develop molecular markers for taxonomy and phylogenetic studies. In this study, the complete mitogenomes (mtDNA) of the three rhombosoleid fishes were determined for the comparative studies and potential development of molecular markers in the future.

Results

The lengths of the complete mitogenome of the three flatfishes are 16,889, 16,588, and 16,937 bp in the order mentioned above. The difference of lengths mainly results from the presence of tandem repeats at the 3′-end with variations of motif length and copy number in the control regions (CR). The gene content and arrangement is identical to that of the typical teleostean mtDNA. Two large intergenic spacers of 28 and 18 bp were found in P. flavilatus mtDNA. The genes are highly conserved except for the sizes of ND1 (which is 28 bp shorter than the two others), ND5 (13 bp longer), and tRNA Glu (5 bp longer) in P. flavilatus mtDNA. The symbolic structures of the CRs are observed as in other fishes, including ETAS, CSB-F, E, D, C, B, A, G-BOX, pyrimidine tract, and CSB2, 3.

Conclusions

Comparative genomic analysis within rhombosoleids revealed that the mitogenomic feature of P. flavilatus was significantly different from that of the two others. Base composition, gene arrangement, and CR structure were carried on in the 17 mitogenomes. Apart from gene rearrangement in two tongue soles (Cynoglossus semilaevis and Cynoglossus abbreviatus), the gene order in 15 others is identical to that of the typical fish mitogenomes. Of the 16 studied mitogenomes, 15 species (except for Zebrias zebrinus) have tandem repeats at the 3′-, 5′-, or both 3′- and 5′-ends of the CRs. Moreover, the motif length and copy number intraspecies or interspecies are also variable. These phenomena fully indicate the diversity of repeats in flatfish mtDNA and would provide useful data for studies on the structure of mitogenomes in fishes.

Keywords

Peltorhamphus novaezeelandiae Colistium nudipinnis Pelotretis flavilatus mtDNA

Background

Flatfishes share a common asymmetrical body and bottom-dwelling mode of life. Their high phenotypic similarity has provoked great confusion in the number and nomenclature of taxa depending on the relevance assigned to morphological features (Chapleau [1993]; Cooper and Chapleau [1998]; Hoshino [2001]). These facts have made it necessary to develop molecular markers to figure out controversial aspects of flatfish systematics.

Generally, mitochondrial DNA (mtDNA) in vertebrata consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, 1 origin of replication on the light strand (OL), and a single large control region (CR). Most genes are encoded by the heavy (H-) strand while only the ND6 gene and eight tRNA genes are encoded by the light (L-) strand (Boore [1999]). Due to its simple structure, the lack of recombination, multi-copy status in a cell, maternal inheritance, and high evolutionary rate, the mtDNA has been extensively used for population genetic study and phylogenetic analysis (Miya et al. [2003]; Inoue et al. [2010]; Shi et al. [2011]).

To date, several genes of mtDNA have been used as molecular markers in the establishment of phylogenetic relationships among flatfishes, such as rRNA genes (Azevedo et al. [2008]), the cytochrome b gene (Borsa and Quignard [2001]), the control region (Tinti et al. [1999]), and their combinations (Infante et al. [2004]). Nevertheless, it has been shown that the use of limited sequence data and markers with different evolving rates may cause errors in inferences of the evolutionary relationships among taxa. In this sense, complete mitochondrial genomes have demonstrated their ability in resolving persistent controversies over higher level relationships of teleost (Miya et al. [2003]; Kawahara et al. [2008]; Inoue et al. [2010]; Shi et al. [2011]). Currently, the complete mtDNA sequences of more than 1,000 fish species have been determined (as of 21 April 2013, http://www.ncbi.nlm.nih.gov/), including 14 species from 6 families in Pleuronectiformes.

Peltorhamphus novaezeelandiae (common sole), Colistium nudipinnis (turbot), and Pelotretis flavilatus (lemon sole) belong to the family Rhombosoleidae of Pleuronectiformes (Nelson [2006]). These fishes are primarily in a South Pacific group, occurring mostly around Australia and New Zealand. Up to now, there has been controversy over the taxonomic status of the rhombosoleids. Regan ([1910]) separated Pleuronectidae into three subfamilies: Pleuronectinae, Samarinae, and Rhombosoleinae, and Hubbs ([1945]) also admitted this opinion. Then, Chabanaud ([1946]) recommended a familial ranking for Rhombosoleinae based on their three ‘highly important’ morphological characteristics. However, this recommendation was not widely accepted. Only some researchers agreed with the classification (Chapleau and Keast [1988]; Cooper and Chapleau [1998]; Guibord [2003]; Nelson [2006]), while the others kept using a subfamilial ranking (Sakamoto [1984]; Li and Wang [1995]; Schwarzhans [1999]; Evseenko [2004]).

Previously, there were no reports on the complete mitogenome of rhombosoleid fishes, and only a few mitogenomic fragments are available. In the present study, the complete mitochondrial sequences of the three rhombosoleid fishes were determined for the first time. The genomic features of these mitogenomes were analyzed and compared with other flatfish mtDNAs. The results of this study could provide useful data for the studies of mitogenome structures in fishes and the development of molecular markers to explore the classification issues within Rhombosoleidae and Pleuronectiformes in the future.

Methods

Sampling, DNA extraction, PCR, and sequencing

Fish samples were obtained from the Sydney fish market, Australia, and preserved in 75% ethanol. The ethical approval is not required because the specimen used in the present study was common marine captured economic fishes, and all fish specimens had died when we obtained them and they were sourced from commercial fisheries. Those species were not involved in the endangered list of IUCN. Total genomic DNAs were extracted from muscular tissues with DNA extraction kit (TIANGEN Biotech, Beijing, China) by following the manufacturer’s protocol.

The primers used to amplify the contiguous (Table 1), overlapping segments of complete mitochondrial genomes of the three rhombosoleid fishes were designed by aligning and comparing with previously reported mitogenomic sequences of flatfishes or other references (Palumbi et al. [1991]; Kong et al. [2009]; Shi et al. [2011]). The PCR was performed in a 25-μl reaction volume containing 0.2 mM dNTP, 0.5 μM of each primer, 1.0 U Taq polymerase (Takara, Dalian, China), 2.5 μl of 10× LA PCR Buffer II (Mg2+ Plus), and approximately 50 ng DNA template. The PCR cycling included an initial denaturation at 95°C for 3 min, 35 cycles of a denaturation at 95°C for 30 s, an annealing step at 48°C for 40 s, elongation at 68°C to 72°C for 1 to 4 min, and a final extension at 72°C for 10 min. The PCR products were detected in 1.0% agarose gels, purified with the Takara Agarose Gel DNA Purification Kit (Takara Bio Inc., Beijing, China) and used directly as templates for the cycle sequencing reactions in both directions (with ABI 3730 DNA sequencer, Life Technologies Biotechnology Corporation, Shanghai, China). Fragments that could not be directly sequenced were inserted into the pMD20-T vector (Takara), transformed into E. coli DH5α for cloning and then sequenced. The new primers were designed for walking sequencing. An overlap of more than 30 bp between the two adjacent sequences was used to ensure the correct assembly and integrity of the complete sequences.
Table 1

PCR primers for amplification of the complete mitogenome of three rhombosoleid species

Forward

Sequence (5′-3′ )

Reverse

Sequence (5′-3′ )

Pleur-Z15

ATTAAAGCATAACHCTGAAGATGTTAAGAT

Pleur-F6746

GCGGTGGATTGTAGACCCATARACAGAGGT

Pleur-Z2625

GTTTACGACCTCGATGTTGGATCAGGACAT

Pleur-F13413

TAGCTGCTACTCGGATTTGCACCAAGAGT

Pleur-Z10818

TTYGAAGCAGCCGCMTGATACTGACAYTT

H15149

AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA

L14734

CGAAGCTTGATATGAAAAACCATCGTTG

Pleur-F17147

TAGTTTARTGCGAGAATCCTAGCTTTGGG

Pleur-Z17054

GYCGGTGGTTARAATCCTCCCTACTGCT

Pleur-F11089

TTTAACCAAGACCRGGTGATTGGAAGTC

Pleur-Z13347

AAGGATAACAGCTCATCCGTTGGTCTTAGG

Pleur-F2753

TAGATAGAAACTGACCTGGATTACTCCGGT

Z-Ser

CTCGCAGCAATGAACACT

16SBR

CCGGTCTGAACTCAGATCACGT

Z-6188

GGTGAAAATCCCTTAGTCCC

F12-F-ATP6

ATGTAAAGGCAGCGGTAG

R-COI-8010

CCMCGACGCTACTCTGACTA

F12-F-12S

TGTCTATCACTGCTGGGTT

F18-Z-Ile

CTTGCCCTGGTTGTATGA

F-49

GGCCCATCTTAACATCTTC

F18-Z-Arg

CCCCAAATAAACCCTGAC

F18-F-COII

CTATCCGAGCCTGAACAA

F18-Z-ND4

GCTTTGCCTACTGGTCAT

F18-F-ND4

TCCCACATCCGTCGTCAT

F20-Z-49

CAGCCCTCACAAGACACT

F-14170

ATTCCTCCTCTTTGTGGG

Z-6487

AGCAGACACTCTAATTAAGC

F18-F-Cytb

CGTCCCTCCAGTTGCTCT

F12-Z-Gln

GAGATCAAAACTCTTAGTGC

F-5196

CTAAATGGTTGGGGTATGG

F20-Z6883

TCGGCTCACTTATTTCCC

F20-F7749

ACGAGTGGAGGACATCTT

F20-Z-13347-2

GCCCTCCTCGTAACTTGA

F20-F-17054-2

CCCTCACCCTCAATAAGA

The sequenced fragments were assembled into complete mitochondrial genomes using CodonCode Aligner (vers. 3, CodonCode Corporation, Dedham, MA, USA) and BioEdit (Hall [1999]). Annotation and boundary determination of protein-coding genes and rRNA genes were performed using NCBI-BLAST (http://blast.ncbi.nlm.nih.gov). Alignments with previously published mitogenomic sequences of flatfishes and other closely related bony fishes were carried out to ensure accuracy (Table 2). The transfer RNA genes and their secondary cloverleaf structures were identified using tRNAscan-SE 1.21 (Lowe and Eddy [1997]), with cutoff values set to 1 when necessary. The secondary structures of tRNA Ser (AGC) and tRNA Cys were further constructed by RNA structure (Reuter and Mathews [2010]) and confirmed by examination of their anticodons.
Table 2

Information of the mitogenomes sequences of 17 flatfishes used in present study

Species

Accession number

Genome

Protein-coding gene

Non-coding region

Length (bp)

AT (%)

Length (bp)

AT skew

GC skew

Control region

OLregion

Length

Repeat site

Copy number

Size

Length

Block

Cynoglossus semilaevis

EU366230

16,731

60.59

11,416

0.20

−0.57

982

5′

11.9

32

44

CCGGC

Cynoglossus abbreviatus

NC_014881

16,417

60.35

11,412

0.23

−0.61

661

5′

4.7

18

41

CCGGC

Solea senegalensis

AB270760

16,659

54.63

11,430

0.17

−0.63

1,017

3′

8.1

8

46

CCGGG

Zebrias zebrinus a

JQ700100

16,758

54.81

11,438

0.17

−0.64

1,078

-

-

-

50

CCAGC

Peltorhamphus novaezeelandiae

JQ639065

16,889

 

11,429

0.03

 

1,212

3′

6.1

7

43

CTGGC

      

3′

39.3

7

  

Colistium nudipinnis

JQ639063

16,588

54.33

11,435

−0.02

−0.45

919

3′

7

17

49

CTGGC

Pelotretis flavilatus

KC554065

16,937

56.08

11,427

0.10

−0.51

1,218

3′

2.9

145

49

CTGGC

Verasper variegatus

NC_007939

17,273

54.69

11,433

0.12

−0.57

1,572

3′

8.3

61

47

CCGGC

Verasper moseri

NC_008461

17,588

55.06

11,435

0.13

−0.56

1,889

3′

13.3

61

46

CCGGC

Platichthys stellatus

NC_010966

17,103

53.21

11,438

0.12

−0.50

1,400

3′

3.2

120

48

CCGGC

Kareius bicoloratus b

NC_003176

15,973

53.26

11,436

0.13

−0.51

-

-

-

-

46

CCGGC

Hippoglossus stenolepis

NC_009710

17,841

54.29

11,443

0.17

−0.55

2,135

3′

17.4

61

48

CCGGC

Hippoglossus hippoglossus

NC_009709

17,546

 

11,443

0.16

 

1,841

3′

3

11

48

CCGGC

      

3′

12.4

61

  

Reinhardtius hippoglossoides

NC_009711

18,017

54.9

11,443

0.12

−0.55

2,312

3′

20.3

61

48

CCGGC

Paralichthys olivaceus

AB028664

17,090

53.54

11,428

0.16

−0.55

1,400

3′

5.4

74

48

CCGGT

Scophthalmus maximus

EU419747

 

55.78

11,506

 

−0.56

1,658

3′

61.4

12

45

CCGGT

      

3′

6.4

11

  

Psettodes erumei

NC_020032.1

53.61

11,427

−0.71

1,601

5′

8.7

56

45

CCGGC

      

3′

23.3

8

  

aThere was no repeat units in the control region of Zebrias zebrinus; bthe control region of Kareius bicoloratus was incomplete. 3′ or 5′ indicates that the repeat region is at the 3′- or 5′-end of the control region, respectively.

To compare the mitogenome characteristics among Pleuronectiformes, the complete mitogenome sequences of 14 other flatfishes from 6 families were retrieved from GenBank (Table 2).

Results and discussion

Genome organization

The lengths of the P. novaezeelandiae, C. nudipinnis, and P. flavilatus mitogenomes are 16,889, 16,588, and 16,937 bp, respectively (GenBank accession no. JQ639065, JQ639063, KC554065; note, the order of the following data is the same as these). Their gene arrangements are identical to those of typical teleost species (Saitoh et al. [2000]; Yue et al. [2006]). All the three mitogenomes contain 13 protein-coding genes, two rRNA genes, 22 tRNA genes, one OL, and one CR. All genes are encoded by the H-strand except for the ND6 and eight tRNA genes, which were encoded on the L strand (Table 3). Base compositions of the three mitogenomes are 26.6% to 28.2%, 27.1% to 28.1%, 16.7% to 17.6%, and 27.7% to 28.1% for A, C, G, and T, respectively, with a bias on AT content (54.3% to 56.1%). A total of 34-, 28-, and 66-bp intergenic spacers are found in the three genomes. The majority of spacer lengths range from 1 to 7 bp except for the two larger spacers in P. flavilatus. One is 28 bp between tRNA Leu (UUA) and ND1, and the other is 18 bp between tRNA Asp and COII, which is a polymeric C fragment. A total of 37-bp, 37-bp, and 39-bp overlaps, respectively, were observed. The four notable over-lapping positions (ATP8 and ATP6, ATP6 and COIII, ND4L and ND4, ND5 and ND6) were also observed as reported in other vertebrate species (Kong et al. [2009]) (Table 3).
Table 3

Features of the mitogenomes of three rhombosoleid fishes

 

Peltorhamphus novaezeelandiae

Colistium nudipinnis

Pelotretis flavilatus

  

Start

Stop

  

Start

Stop

  

Start

Stop

 

Gene

Position

anticodon

I-R*

Position

anticodon

I-R

Position

anticodon

I-R

tRNA Phe

1 to 68

GAA

0

1 to 68

GAA

0

1 to 69

GAA

0

12S rRNA

69 to 1,010

 

0

69 to 1,010

 

0

70 to 1,016

 

0

tRNA Val

1,011 to 1,081

TAC

0

1,011 to 1,081

TAC

0

1,017 to 1,087

TAC

0

16S rRNA

1,082 to 2,795

 

1

1,082 to 2,792

 

1

1,088 to 2,816

 

0

tRNA Leu( UUA )

2,797 to 2,870

TAA

0

2,794 to 2,867

TAA

0

2,817 to 2,890

TAA

28

ND1

2,871 to 3,845

ATG

TAA

5

2,868 to 3,842

ATG

TAA

5

2,919 to 3,866

ATG

TAA

6

tRNA Ile

3,851 to 3,920

GAT

−1

3,848 to 3,917

GAT

−1

3,873 to 3,942

GAT

−1

tRNA Gln

3,920 to 3,990

TTG

−1

3,917 to 3,987

TTG

−1

3,942 to 4,013

TTG

−1

tRNA Met

3,990 to 4,059

CAT

0

3,987 to 4,055

CAT

1

4,013 to 4,081

CAT

1

ND2

4,060 to 5,109

ATG

TAA

−1

4,057 to 5,106

ATG

TAA

−1

4,083 to 5,132

ATG

TAA

−1

tRNA Trp

5,109 to 5,179

TCA

1

5,106 to 5,176

TCA

1

5,132 to 5,202

TCA

1

tRNA Ala

5,181 to 5,249

TGC

1

5,178 to 5,246

TGC

1

5,204 to 5,272

TGC

1

tRNA Asn

5,251 to 5323

GTT

0

5,248 to 5,320

GTT

0

5,274 to 5,346

GTT

0

OL

5,324 to 5,361

 

−4

5,321 to 5,364

 

−4

5,347 to 5,390

 

−4

tRNA Cys

5,358 to 5,417

GCA

−1

5,361 to 5,420

GCA

−1

5,387 to 5,446

GCA

−1

tRNA Tyr

5,417 to 5,486

GTA

1

5,420 to 5,489

GTA

1

5,446 to 5,515

GTA

1

COI

5,488 to 7,038

GTG

TAA

0

5,491 to 7,041

GTG

TAA

0

5,517 to 7,067

GTG

TAA

0

tRNA Ser (UCA)

7,039 to 7,109

TGA

3

7,042 to 7,112

TGA

3

7,068 to 7,138

TGA

3

tRNA Asp

7,113 to 7,181

GTC

6

7,116 to 7,184

GTC

6

7,142 to 7,210

GTC

18

COII

7,188 to 7,880

ATG

TAA

7

7,191 to 7,881

ATG

T-

0

7,229 to 7,919

ATG

T-

0

tRNA Lys

7,888 to 7,961

TTT

1

7,882 to 7,955

TTT

1

7,920 to 7,993

TTT

1

ATP8

7,963 to 8,130

ATG

TAA

−10

7,957 to 8,124

ATG

TAA

−10

7,995 to 8,162

ATG

TAA

−10

ATP6

8,121 to 8,804

ATG

TAA

−1

8,115 to 8,798

ATG

TAA

−1

8,153 to 8,836

ATG

TAA

−1

COIII

8,804 to 9,589

ATG

TAA

−1

8,798 to 9,583

ATG

TAA

−1

8,836 to 9,621

ATG

TAA

−1

tRNA Gly

9,589 to 9,660

TCC

−3

9,583 to 9,654

TCC

−3

9,621 to 9,691

TCC

−3

ND3

9,658 to 10,011

ATA

TAG

−2

9,652 to 10,005

ATA

TAG

−2

9,689 to 10,042

ATA

TAG

−2

tRNA Arg

10,010 to 10,078

TCG

0

10,004 to 10,072

TCG

0

10,041 to 10,109

TCG

0

ND4L

10,079 to 10,375

ATG

TAA

−7

10,073 to 10,369

ATG

TAA

−7

10,110 to 10,406

ATG

TAA

−7

ND4

10,369 to 11,749

ATG

T-

0

10,363 to 11,743

ATG

T-

0

10,400 to 11,780

ATG

T-

0

tRNA His

11,750 to 11,818

GTG

0

11,744 to 11,812

GTG

0

11,781 to 11,849

GTG

0

tRNA Ser (AGC)

11,819 to 11,885

GCT

4

11,813 to 11,879

GCT

4

11,850 to 11,916

GCT

4

tRNA Leu (CUA)

11,890 to 11,962

TAG

0

11,884 to 11,956

TAG

0

11,921 to 11,993

TAG

1

ND5

11,963 to 13,801

ATG

TAA

−4

11,957 to 13,795

ATG

TAG

−4

11,995 to 13,845

ATG

TAA

−4

ND6

13,798 to 14,319

ATG

TAG

0

13,792 to 14,313

ATG

TAG

0

13,842 to 14,363

ATG

TAG

1

tRNA Glu

14,320 to 14,388

TTC

4

14,314 to 14,382

TTC

4

14,365 to 14,438

TTC

−2

Cytb

14,393 to 15,533

ATG

T-

0

14,387 to 15,527

ATG

T-

0

14,437 to 15,577

ATG

T-

0

tRNA Thr

15,534 to 15,607

TGT

−1

15,528 to 15,599

TGT

−1

15,578 to 15,649

TGT

−1

tRNA Pro

15,607 to 15,677

TGG

0

15,599 to 15,669

TGG

0

15,649 to 15,719

TGG

0

D-loop

15,678 to 16,889

  

15,670 to 16,588

  

15,720 to 16,937

  

I-R*, intergenic region; non-coding bases between the feature on the same line and the line below, with a negative number indicating an overlap.

Protein-coding genes

The sizes of the 13 protein-coding genes are 11,441 bp in P. novaezeelandiae and C. nudipinnis but are 11,424 bp in P. flavilatus. Comparison of the length of each gene reveals that the genes are highly conserved in size except for the ND1 gene (28 bp shorter) and the ND5 gene (13 bp longer) in P. flavilatus mtDNA. The start codons are identical in the three species. Eleven genes use the ATG, whereas COI starts with GTG, and ND3 with ATA, which has rarely been found in fish mitogenomes to date (other examples include Albula glossodonta, Monopterus albus, Petroscirtes breviceps, Solea senegalensis, and Cynoglossus semilaevis) (Miya et al. [2003]; Miya et al. [2001]; Inoue et al. [2004]; Kong et al. [2009]). Ten of the 13 genes use the same stop codons. The ND5 gene ends with TAA in P. novaezeelandiae and P. flavilatus and TAG in C. nudipinnis; the COII and cytb end with TAA in P. novaezeelandiae, but with T in C. nudipinnis and P. flavilatus (Table 3).

The base compositions of the 13 protein-coding genes are T > C > A > G. The proportions of the four bases have no apparent bias at the first codon position but have significant difference at the second and third positions. The percentage of T at the second position is up to 40.9% to 41.1%, but that of G is only 13.6% to 13.8%. In particular, G at the third position is only 9.6% to 12.5%, which is in agreement with previous reports (Saitoh et al. [2000]; Miya et al. [2003]; Oh et al. [2007]). There is a slight difference in codon usage among three rhombosoleids. The most frequently used amino acid is leucine (16.5% to 17.2%), while cysteine (0.7% to 0.8%) is the least frequently used. The level of homology of genes between the three rhombosoleid species ranges from 63% (ND2 gene) to 85% (COII gene). The similarity between C. nudipinnis and P. flavilatus is generally higher than that between P. novaezeelandiae and each of these two fishes (Figure 1).
Figure 1

Sequence identities of 13 protein genes and two rRNA genes among the three rhombosoleids.

Ribosomal and transfer RNA genes

Two rRNA genes are typically located between tRNA Phe and tRNA Leu (UUA) and separated by tRNA Val (Table 3). The lengths of 12S rRNA genes are similar and those of 16S rRNA have approximately 15 bp differences among three species (Table 3). The level of homology of rRNA genes is very similar in 12S rRNA but slightly different in 16S rRNA among the three rhombosoleids (Figure 1).

The 22 tRNA genes are interspersed between rRNA and protein-coding genes. Most of these tRNAs are of similar length as those in other fishes, except for tRNA Glu , which is 5 bp longer in P. flavilatus than those in the other fishes. The majority of tRNA genes could be recognized and folded into secondary structures by tRNAscan-SE, except for two genes that were identified by comparing with other flatfishes. One is the tRNA Ser (AGC) gene in C. nudipinnis and P. flavilatus, which is the common case in fishes, and another is the tRNA Cys gene, in which the dihydrouracil loop cannot be formed in any of the three fishes’ mtDNA. The lengths are7, 5, 4, and 5 bp for that of the amino acid arm, anticodon arm, and DHU and TΨC arm, respectively. Both the anticodon and TΨC loop are 7 nucleotides long, whereas DHU loop size varies from 5 to 11 nucleotides.

Non-coding sequences

The OL is normally located between tRNA Asn and tRNA Cys in the WANCY region and is from 38 to 44 bp in size. These regions have the potential to fold into a stem-loop structure with 13 or 14 bp in the arms and 10 or 14 nucleotides in the loops. The highly conserved sequence motif 5′-GCCAG-3′ is substituted by 5′-GCCGG-3′ (Figure 2).
Figure 2

The stem-loop structures of O L in the mitogenomes of three rhombosoleids. The underlined sequences indicate the conserved sequence motif. (a) P. novaezeelandiae, (b) C. nudipinnis, and (c) P. flavilatus.

The control regions are commonly situated in the location between tRNA Pro and tRNA Phe . Their lengths are quite different and are 919, 1,212, and 1,218 bp in C. nudipinnis, P. novaezeelandiae, and P. flavilatus, respectively (Table 3). These differences mainly result from the presence of tandem repeats at the 3′-end, in which the motif length and copy number of tandem repeat are variable. There are two 7-bp motifs with 6 or 39 copies in P. novaezeelandiae, a 17-bp motif with seven copies in C. nudipinnis, and a 145-bp motif with three copies in P. flavilatus (Figure 3).
Figure 3

Alignment of the control regions of P. novaezeelandiae ( P.nov ), C. nudipinnis ( C.nud ), and P. flavilatus ( P.fla ) mtDNA. The blocks CSB-A, B, C, D, E, F, poly-T, and CSB-2 and CSB-3 are shaded. CSB, conserved sequence block. The sequence in parentheses indicates the motif of the tandem repeat, and the arabic number indicates the copy number.

The AT contents of the CRs reach up to 64.4% to 66.7%, which are higher than those of the whole mtDNA sequences. The symbolic structures of the CRs are observed as in other fishes (Figure 3), including the extended termination associated sequence (ETAS, containing TAS-cTAS: TACAT-ATGTA), central conserved sequence blocks (CSB-F,E,D), G-BOX (GTGGGGG), pyrimidine tract (poly-T), and conserved sequence blocks (CSB 2-3) (Nesbo et al. [1998]; Manchado et al. [2007]; Wang et al. [2013]).

Comparative analyses with other flatfishes

Up to now, 14 mitogenome sequences from other flatfishes had been determined (Table 2). To better understand their features of mtDNAs, a comparative analysis was carried out in several aspects.

First of all, the content of the 17 mitogenome sequences (including three from the present study) are the same, which consists of 37 genes, 1 OL, and 1 CR. However, the gene arrangements differ among them. Apart from the two tongue soles (C. semilaevis and C. abbreviatus), the orders of the 15 others are identical to that of the typical fish mitogenomes. The organization of the tongue sole mitogenomes differed, in which the tRNA Gln gene is inverted from the light strand to the heavy strand (inversion), accompanied by shuffling of the tRNA Ile gene and long-range translocation of the control region downstream to a site between the ND1 and the tRNA Gln genes.

The lengths of the 17 mitogenome sequences show apparent differences (from 15,973 bp of Kareius bicoloratus to 18,017 bp of Reinhardtius hippoglossoides). The reason for the short CR in K. bicoloratus mtDNA is due to the unfinished sequencing of CR and that for two other tongue soles (16,417 bp or 16,731 bp) is due to the rearrangement of the CR. The variations for the other fishes are primarily caused by the presence of the repeated arrays in control regions.

The proportions of three bases (A\T\C) have no obvious difference, ranging from 20% to 30%; however, that of G is remarkably lower, from 14.5% (C. semilaevis) to 17.7% (Platichthys stellatus). The AT compositions in the 15 species mitogenomes are generally approximately 50% (from 53.21% to 56.08%), but those of the two tongue soles reach up to 60.35% and 60.59% (Table 2).

Gene region

The lengths of the gene sequences are relatively conservative, except for the ND2 gene (1,110 bp) of Scophthalmus maximus (approximately 50 bp longer) and the ND1 gene (948 bp) of P. flavilatus (approximately 25 bp shorter). For the other genes, no significant difference was observed.

In this study, the AT and GC skews of 13 proteins in the 17 flatfish mitogenomes were analyzed. Compositional skew was estimated using the following formulas: GC skew = (G − C)/(G + C) and AT skew = (A − T)/(A + T), where C, G, A, and T are the frequencies of the four bases at the third codon position of the eight fourfold degenerate codon families (Perna and Kocher [1995]). With the exception of AT skew in C. nudipinnis, 16 of 17 mtDNAs show a typical negative GC skew and positive AT skew. The absolute values of the GC skews are always higher than those of the AT skews, with the former ranging from 0.45 to 0.71 and the latter from 0.02 to 0.39 (Table 2). These results indicate that the usage of the G/C was more unbalanced than the A/T in the studied flatfishes.

Non-coding sequences

All the OL of the 17 flatfishes mitogenomes are situated at the typical site of bony fishes. The lengths range from 41 bp (C. abbreviatus) to 50 bp (Zebrias zebrinus) (Table 2). All these regions have the potential ability to fold into a stem-loop structure with 11 to 15 bp in the arms and 10 to 15 bp nucleotides in the loops. The highly conserved sequence motif of 5′-GCCGG-3′ is substituted in some species, such as by 5′-CCCGG-3′ in Z. zebrinus, 5′-GCCAG-3′ in rhombosoleids, and 5′-ACCGG-3′ in Paralichthys olivaceus and S. maximus (Table 2).

The control region of the 14 mitogenomes (excluding the unfinished one K. bicoloratus) is typically situated in the place between tRNA Pro and tRNA Phe except for the two tongue soles (which is between ND1 and tRNA Gln ). The lengths are quite different, from 661 bp (C. abbreviatus) to 2,312 bp (R. hippoglossoides). The differences of length primarily result from the presence of tandem repeats within the CR. The repeat regions in Psettodes erumei exist at both 5′- and 3′- ends of the CR, while that in the others are located at either the 5′-end in the tongue soles or the 3′-end in the rest fishes. The motif lengths and copy numbers of tandem repeat are variable within species or interspecies (Table 2). The specific case is the absence of a repeat region in Z. zebrinus.

Based on the alignment of CR sequences of 14 flatfishes, the typical tripartite structure was found as those in P. novaezeelandiae, C. nudipinnis, and P. flavilatus mtDNA. The six blocks of CSB-F, E, D, C, B, and A were identified in the central conserved blocks domain, and the key sequences of each block are as follows: CSB-F: GTAAGAGCCTACCAACCGG, CSB-E: GGGTGAGGGACAAAAATT -GTGGGGG, CSB-D: TATTCCTGGCATTTGGTTCC-TACTTCAGGGCCAT, CSB-C: CTTACATAAGTTAATG, CSB-B: CATACGACTCGTTACCCAGCAAGCCGGGCGTTC; CSB-A: CTCCAGCGGGTAAGGGG. The G-box (GTGGGGG) is the most conservative in CSB-E. Simultaneously, a pyrimidine tract following the CSB-A was also identified (TTCTC-TTTTTT TTTTTCCTTTC). Two conserved sequence blocks of CSB-2 and CSB-3 at the 3′-end of the CR were identifiable; their sequences are CSB-2: AAAACCCCCC-TACCCCCCTAAA and CSB-3: CCTGAAAACCCCCCGG, respectively (see Additional file 1).

Generally, the variation of the control region is relatively greater than that of the other sequences in the mitogenome. However, there have also been some conserved structures in the CR as they are supposed to contain the functional structures, such as the origins of the H-strand (OH), the heavy strand promoter (HSP), and light strand promoter (LSP) of transcription transcripts (Shadel and Clayton [1997]). So far, the sequences of some conserved blocks have not been defined. Generally, only the TAS, CSB-F, E, and D of the central conserved blocks are identified in most fishes, while the CSB-C, B, and A are greatly variable (Lee et al. [1995]; Guo et al. [2003]; Manchado et al. [2007]; Zhang et al. [2010]), and CSB-1,2,3 have been found only in some fishes (Lee et al. [2001]; Liu [2002]; Guo et al. [2003]).

Conclusions

We sequenced the complete mitogenomes of three rhombosoleid fishes in the Pleuronectiformes. Comparative genomic analysis within the rhombosoleids revealed that the genomic feature of P. flavilatus is apparently different from the other two.

The comparison of complete mitogenome sequences of 3 rhombosoleids with that of the other 14 flatfishes show some different features among them. Firstly, the genomic arrangement of the 15 mitogenomes is identical to that of a typical teleost, but the order of two tongue soles showed clear rearrangements. Secondly, the length heterogeneity is apparently large and up to 1,600 bp. The main reason for this case is due to the presence of repeat regions in the CRs. The 15 species have tandem repeats, which were distributed at all potential existing sites in the CR, including 3′-, 5′-, or both 3′- and 5′-ends of the CR. Moreover, the motif length and copy number in intraspecies or interspecies are also variable. Thirdly, six blocks of CSB-F, E, D, C, B, and A in the central conserved blocks domain and CSB-2 and CSB-3 in the conserved sequence blocks were identified. However, CSB-1 is not conserved in the flatfishes studied. These phenomena fully indicated the diversity of repeats in flatfishes and would provide useful data for further studies on the structure of mitogenomes in fishes.

Summarily, the complete mitogenomic sequences of rhombosoleids and rich molecular information were obtained in this study. It will contribute to figuring out the existing controversy, such as the taxonomic status and phylogenetic relations of rhombosoleids. Comparative genomics analysis within flatfishes conducted here may help better understand the evolution of mitogenomic structures and explore the phylogenetic relationships of the Pleuronectiforms.

Data accession

Sequences were deposited in the NCBI [no. JQ639065, JQ639063, KC554065].

Additional file

Declarations

Acknowledgements

We are very grateful to Mr. Bernard Yau for his help in collecting the rhombosoleids samples from Australia. This study is supported by the National Natural Science Foundation of China (30870283 and 31471979).

Authors’ Affiliations

(1)
Key Laboratory of Tropical Marine Bio-resources and Ecology, Marine Biodiversity Collection of South China Sea, South China Sea Institute of Oceanology, Chinese Academy of Sciences

References

  1. Azevedo MFC, Oliveira C, Pardo BG, Martinez P, Foresti F: Phylogenetic analysis of the order Pleuronectiformes (Teleostei) based on sequences of 12S and 16S mitochondrial genes. Genet Mol Biol 2008,31(1):284–292. 10.1590/S1415-47572008000200023View ArticleGoogle Scholar
  2. Boore J: Animal mitochondrial genomes. Nucleic Acids Res 1999, 27: 1767–1780. 10.1093/nar/27.8.1767PubMed CentralView ArticlePubMedGoogle Scholar
  3. Borsa P, Quignard JP: Systematics of the Atlantic-Mediterranean soles Pegusa impar, P. lascaris, Solea aegyptiaca, S. senegalensis, and S. solea (Pleuronectiformes:Soleidae). Can J Zool 2001,79(12):2297–2302.Google Scholar
  4. Chabanaud P: Sur le véritable caractère externe, par quoi les Soleiformes diffèrent des Pleuronectiformes. Bull Mus Natl Hist Nat 1946, 18: 158–160.Google Scholar
  5. Chapleau F: Pleuronectiform relationships: a cladistic reassessment. Bull Mar Sci 1993,52(1):516–540.Google Scholar
  6. Chapleau F, Keast A: A phylogenetic reassessment of the monophyletic status of the family Soleidae, with comments on the suborder Soleoidei (Pisces; Pleuronectiformes). Can J Zool 1988,66(12):2797–2810. 10.1139/z88-408View ArticleGoogle Scholar
  7. Cooper JA, Chapleau F: Monophyly and intrarelationships of the family Pleuronectidae (Pleuronectiformes), with a revised classification. Fish Bull 1998,96(4):686–726.Google Scholar
  8. Evseenko S: Family Pleuronectidae Cuvier 1816—righteye flounders. Calif Acad Sci Annotated Checklists Fishes 2004, 37: 1–37.Google Scholar
  9. Guibord AC: Taxonomic revision of the Poecilopsettidae and phylogenetic analysis of the Rhombosoleidae and Pleuronectiformes (Acanthopterygii): Révision toxinomique des Poecilopsettidae et phylogénèse des Rhombosoleidae et des Pleuronectiformes (Acanthopterygii). Univ Ottawa, Ottawa; 2003.Google Scholar
  10. Guo X, Liu S, Liu Y: Comparative analysis of the mitochondrial DNA control region in cyprinids with different ploidy level. Aquaculture 2003,224(1):25–38. 10.1016/S0044-8486(03)00168-6View ArticleGoogle Scholar
  11. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999, 41: 95–98.Google Scholar
  12. Hoshino K: Homologies of the caudal fin rays of Pleuronectiformes (Teleostei). Ichthyol Res 2001,48(3):231–246. 10.1007/s10228-001-8141-6View ArticleGoogle Scholar
  13. Hubbs CL: Phylogenetic position of the Citharidae, a family of flatfishes. University of Michigan Press, Canton; 1945.Google Scholar
  14. Infante C, Catanese G, Manchado M: Phylogenetic relationships among ten sole species (Soleidae, Pleuronectiformes) from the Gulf of Cadiz (Spain) based on mitochondrial DNA sequences. Mar Biotechnol 2004,6(6):612–624. 10.1007/s10126-004-3081-6View ArticlePubMedGoogle Scholar
  15. Inoue JG, Miya M, Tsukamoto K, Nishida M: Mitogenomic evidence for the monophyly of elopomorph fishes (Teleostei) and the evolutionary origin of the leptocephalus larva. Mol Phylogenet Evol 2004,32(1):274–286. 10.1016/j.ympev.2003.11.009View ArticlePubMedGoogle Scholar
  16. Inoue JG, Miya M, Miller MJ, Sado T, Hanel R, Hatooka K, Aoyama J, Minegishi Y, Nishida M, Tsukamoto K: Deep-ocean origin of the freshwater eels. Biol Lett 2010,6(3):363–366. 10.1098/rsbl.2009.0989PubMed CentralView ArticlePubMedGoogle Scholar
  17. Kawahara R, Miya M, Mabuchi K, Lavoue S, Inoue JG, Satoh TP, Kawaguchi A, Nishida M: Interrelationships of the 11 gasterosteiform families (sticklebacks, pipefishes, and their relatives): a new perspective based on whole mitogenome sequences from 75 higher teleosts. Mol Phylogenet Evol 2008,46(1):224–236. 10.1016/j.ympev.2007.07.009View ArticlePubMedGoogle Scholar
  18. Kong X, Dong X, Zhang Y, Shi W, Wang Z, Yu Z: A novel rearrangement in the mitochondrial genome of tongue sole, Cynoglossus semilaevis: control region translocation and a tRNA gene inversion. Genome 2009,52(12):975–984. 10.1139/G09-069View ArticlePubMedGoogle Scholar
  19. Lee WJ, Conroy J, Howell WH, Kocher TD: Structure and evolution of teleost mitochondrial control regions. J Mol Evol 1995,41(1):54–66. 10.1007/BF00174041View ArticlePubMedGoogle Scholar
  20. Lee J-S, Miya M, Lee Y-S, Kim CG, Park E-H, Aoki Y, Nishida M: The complete DNA sequence of the mitochondrial genome of the self-fertilizing fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and the first description of duplication of a control region in fish. Gene 2001,280(1):1–7. 10.1016/S0378-1119(01)00765-XView ArticlePubMedGoogle Scholar
  21. Li SZ, Wang HM: Fauna Sinica (Osteichthyes): Pleuronectiformes. Science Press, Beijing; 1995.Google Scholar
  22. Liu H: Structure and evolution of fish mitochondrial control region, bitterlings as example. Prog Nat Sci 2002, 12: 266–270.Google Scholar
  23. Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 1997,25(5):955–964. 10.1093/nar/25.5.0955PubMed CentralView ArticlePubMedGoogle Scholar
  24. Manchado M, Catanese G, Ponce M, Funes V, Infante C: The complete mitochondrial genome of the Senegal sole, Solea senegalensis Kaup. Comparative analysis of tandem repeats in the control region among soles. Mitochondrial DNA 2007,18(3):169–175.Google Scholar
  25. Miya M, Kawaguchi A, Nishida M: Mitogenomic exploration of higher teleostean phylogenies: a case study for moderate-scale evolutionary genomics with 38 newly determined complete mitochondrial DNA sequences. Mol Biol Evol 2001,18(11):1993–2009. 10.1093/oxfordjournals.molbev.a003741View ArticlePubMedGoogle Scholar
  26. Miya M, Takeshima H, Endo H, Ishiguro NB, Inoue JG, Mukai T, Satoh TP, Yamaguchi M, Kawaguchi A, Mabuchi K, Shirai SM, Nishida M: Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Mol Phylogenet Evol 2003,26(1):121–138. 10.1016/S1055-7903(02)00332-9View ArticlePubMedGoogle Scholar
  27. Nelson JS: Fishes of the World(Fourth Edition). John Wiley, Inc, New York; 2006.Google Scholar
  28. Nesbo CL, Arab MO, Jakobsen KS: Heteroplasmy, length and sequence variation in the mtDNA control regions of three percid fish species ( Perca fluviatilis , Acerina cernua , Stizostedion lucioperca ). Genetics 1998,148(4):1907–1919.PubMed CentralPubMedGoogle Scholar
  29. Oh DJ, Kim JY, Lee JA, Yoon WJ, Park SY, Jung YH: Complete mitochondrial genome of the rock bream Oplegnathus fasciatus (Perciformes, Oplegnathidae) with phylogenetic considerations. Gene 2007,392(1–2):174–180. 10.1016/j.gene.2006.12.007View ArticlePubMedGoogle Scholar
  30. Palumbi S, Martin A, Romano S, McMillan W, Stice L, Grabowski G (1991) The Simple Fool’s Guide to PCR, Version 2.0, privately published document compiled by S. Palumbi. Dept. Zool Univ Hawaii Honolulu HI 96:822Google Scholar
  31. Perna NT, Kocher TD: Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J Mol Evol 1995,41(3):353–358. 10.1007/BF01215182View ArticlePubMedGoogle Scholar
  32. Regan CT: The origin and evolution of the teleostean fishes of the order Heterosomata. Ann Mag Nat Hist 1910, 6: 484–496. 10.1080/00222931008692879View ArticleGoogle Scholar
  33. Reuter JS, Mathews DH: RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 2010, 11: 129. 10.1186/1471-2105-11-129PubMed CentralView ArticlePubMedGoogle Scholar
  34. Saitoh K, Hayashizaki K, Yokoyama Y, Asahida T, Toyohara H, Yamashita Y: Complete nucleotide sequence of Japanese flounder ( Paralichthys olivaceus ) mitochondrial genome: structural properties and cue for resolving teleostean relationships. J Hered 2000,91(4):271–278. 10.1093/jhered/91.4.271View ArticlePubMedGoogle Scholar
  35. Sakamoto K: Interrelationships of the family Pleuronectidae (Pisces: Pleuronectiformers). Mem Fac Fish Hokkaido Univ 1984, 31: 95–215.Google Scholar
  36. Schwarzhans W: A comparative morphological treatise of recent and fossil otoliths of the order Pleuronectiformes. F. Pfeil, Verlag; 1999.Google Scholar
  37. Shadel GS, Clayton DA: Mitochondrial DNA maintenance in vertebrates. Annu Rev Biochem 1997,66(1):409–435. 10.1146/annurev.biochem.66.1.409View ArticlePubMedGoogle Scholar
  38. Shi W, Kong XY, Wang ZM, Jiang JX: Utility of tRNA genes from the complete mitochondrial genome of Psetta maxima for implying a possible sister-group relationship to the Pleuronectiformes. Zool Stud 2011,50(5):665–681.Google Scholar
  39. Tinti F, Colombari A, Vallisneri M, Piccinetti C, Stagni A: Comparative analysis of a mitochondrial DNA control region amplified from three Adriatic flatfish species and molecular phylogenesis of Pleuronectiformes. Mar Biotechnol 1999, 1: 20–24. 10.1007/PL00011747View ArticlePubMedGoogle Scholar
  40. Wang Z-M, Shi W, Jiang J-X, Wang S-Y, Miao X-G, Huang L-M, Kong X-Y: The complete mitochondrial genome of a striped sole Zebrias zebrinus (Pleuronectiformes: Soleidae). Mitochondrial DNA 2013,24(6):633–635. 10.3109/19401736.2013.772160View ArticlePubMedGoogle Scholar
  41. Yue G, Liew W, Orban L: The complete mitochondrial genome of a basal teleost, the Asian arowana ( Sclerophages formosus , Osteoglossidae). BMC Genomics 2006, 7: 242. 10.1186/1471-2164-7-242PubMed CentralView ArticlePubMedGoogle Scholar
  42. Zhang Y, Kong X, Wang Z: Characterization of mitochondrial control region sequence of Psettodes erumei and phylogenetic analysis of Pleuronectiformes. J Trop Oceanograph 2010,29(6):71–78.Google Scholar

Copyright

© Wang et al.; licensee Springer. 2014

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.